Menu

Maria Selma Restaurant

L’émergence du paludisme à Plasmodium ovale dans les forces armées françaises en République de Côte d’Ivoire: des années d’expérience clinique et biologique

Contexte La surveillance militaire française a identifié une augmentation des attaques de Plasmodium ovale chez les soldats ivoiriens. Cette émergence et la faible sensibilité des tests biologiques soulèvent la question du rôle éventuel des espèces variantes de P ovale. Méthodes Les données épidémiologiques sur les attaques de P ovale ont été étudiées; le diagnostic des espèces était basé sur un frottis sanguin mince et / ou un test diagnostique rapide. Les caractéristiques cliniques et biologiques des soldats hospitalisés dans les hôpitaux militaires français ont également été examinées. La réaction en chaîne de la polymérase du paludisme a été suivie de génotypage. Parmi les patients ayant des frottis sanguins positifs, le test de diagnostic rapide a été positif dans les tests réalisés. L’étude hospitalière a montré que les symptômes et les changements biologiques n’étaient pas spécifiques, ce qui rendait le diagnostic difficile: fièvre, anémie et La thrombocytopénie n’était pas présente en%,% et% des cas confirmés, respectivement. Il était possible d’effectuer des investigations moléculaires sur des isolats cliniques: étaient des haplotypes classiques avec un polymorphisme additionnel et étaient des variants variants Cette émergence de paludisme P ovale a permis une bonne description chez les patients non immunisés Le manque de sensibilité o Les caractéristiques cliniques et les tests de diagnostic rapides suggèrent une sous-estimation. Les raisons de cette épidémie sont une exposition particulièrement intense aux vecteurs et l’efficacité insuffisante de la doxycycline contre P ovale. Le polymorphisme des haplotypes classiques de P ovale pourrait être impliqué.

Paludisme, Plasmodium ovale, nouvelle variante, République de Côte d’Ivoire, soldatsLa malaria est une menace pour les voyageurs dans les zones endémiques tropicales, en particulier pour les soldats travaillant sur le terrain Chaque année, les soldats français séjournent ou traversent mesures obligatoires de lutte contre les moustiques et chimioprophylaxie chloroquine-proguanil jusqu’à, doxycycline à ce jour Bouts de Plasmodium falciparum sont déjà bien décrits en raison de leur forte incidence et leur gravité, contrairement aux épisodes non falciparum, en particulier les épisodes de Plasmodium ovale, qui sont Le suivi permanent du paludisme chez les forces françaises a permis d’identifier un pic inattendu d’attaques de P ovale chez les soldats pendant ou après un séjour en République de Côte d’Ivoire Comme observé chez les voyageurs civils français , Le paludisme à P. ovale était un événement rare pour les forces françaises avant cette épidémie, bien moins fréquent que P falciparum Cette augmentation inattendue de P ovale à les attentats inquiètent les autorités médicales militaires françaises en raison de l’incapacité des soldats infectés à attaquer sur le terrain; petites éclosions dans plusieurs unités militaires; difficultés diagnostiques dues à la faible sensibilité des outils cliniques et biologiques, y compris les tests de diagnostic rapides utilisés sur le terrain depuis; et la nécessité d’un traitement combiné avec la chloroquine pour guérir l’attaque et la primaquine pour éviter les rechutes subséquentes Récemment, Sutherland et al ont découvert l’existence de sous-espèces putatives de P ovale dans les pays d’Afrique de l’Ouest, qui ont permis d’étudier évolution épidémiologique de la sous-espèce P ovaleLes aspects épidémiologiques, cliniques, biologiques et moléculaires de cette épidémie significative sont rapportés ici et les raisons de cette émergence sont discutées

PATIENTS ET MÉTHODES

La surveillance épidémiologique dans les forces armées françaises est la collecte, l’analyse, l’interprétation et la restitution continues et systématiques des données épidémiologiques sur les principaux événements médicaux infectieux et non infectieux pertinents par tous les médecins militaires La population étudiée est composée de militaires français, quelle que soit leur localisation France, Territoires d’outre-mer français et étrangers La définition de cas de paludisme est soit l’apparition des symptômes associés à la présence de plasmodium sur les frottis sanguins épais et fins, soit la positivité du test quantitatif de QAB et / ou des tests antigéniques de diagnostic rapide: BinaxNOW Malaria, Inverness Medical, Le diagnostic de l’espèce est basé sur un examen microscopique et / ou des tests antigéniques et / ou une réaction en chaîne de la polymérase. PCR Si nécessaire, des échantillons de sang ont été expédiés du terrain ou des hôpitaux au Centre de Référence du Paludisme à Malaria. l’Institut de Médecine Tropicale du Service de Santé Militaire Le Pharo, Marseille pour un diagnostic moléculaire Chaque cas de paludisme doit être déclaré à l’aide d’un questionnaire sur la localisation pendant le séjour, les caractéristiques sociodémographiques, le comportement anti-moustique obligatoire et la chimioprophylaxie, les caractéristiques cliniques et biologiques, le diagnostic parasitologique, Les données de toutes les attaques de paludisme P ovale déclarées au système de surveillance entre et ont été examinées. Un échantillon de ces attaques a été analysé plus profondément par l’étude menée sur tous les soldats ayant une attaque P ovale liée à un séjour en République d’Ivoire. Côte qui ont été gérés entre et dans les hôpitaux militaires Laveran Marseille et Begin Saint-Mandé, qui sont des centres de référence pour la médecine tropicale et les maladies infectieuses pour l’armée française. Les caractéristiques épidémiologiques, cliniques et biologiques, le traitement et les résultats ont également été collectés. un sous-groupe d’une série de patients atteints de malari non falciparum a été importé dans les hôpitaux français Pour les matériels cliniques disponibles, le diagnostic a été complété par la sous-espèce putative P ovale génotypage L’ADN a été extrait des prélèvements sanguins au moyen du kit QIAamp DNA Blood Mini Qiagen Plasmodium ovale reticulocyte-binding protein homologue Porbp: GU / GU et gènes d’antigènes riches en tryptophane P ovale Potra: GU / GU / GU ont été amplifiés par PCR en utilisant les amorces suivantes: : ‘ATGTTGGAAACAACTGACACC’ en avant et ‘GGGCGTAATAGTAAGGTAGCG reverse pour Porbp; « TTAGACATTGAAAATGACCC » avant et GTGTTTGTAGTATTTACAGG inverse pour Potra Le mélange réactionnel consistait en environ ng d’ADN génomique, μM d’amorces sens et antisens, x tampon mM chlorure de potassium, mM Tris, pH, chlorure de magnésium mM, μM de désoxynucléotide triphosphate, et U Red Gold Star DNA polymérase Eurogentec dans un volume final de μL Le thermocycleur T Biometra a été programmé comme suit: un ° C initial pour les minutes, suivi des cycles de ° C pour les secondes, ° C pour les secondes, et ° C pour les secondes pour le Porbp et les cycles de ° C pour secondes, ° C pour secondes, et ° C pour secondes pour Potra Une dernière étape d’extension -minute a été effectuée à ° C pour Porbp et ° C pour Potra Les produits PCR ont été chargés sur% gel d’agarose contenant μg / mL d’éthidium bromure Les fragments amplifiés ont été purifiés en utilisant le kit de purification de produit High Pure PCR Roche. Les fragments purifiés ont été séquencés en utilisant la version de kits de réaction prêts à séquencer de cycle Big Dye Terminator d’ABI Prism; Applied Biosystems utilisant les amorces décrites ci-dessus Les produits de réaction séquencés ont été purifiés à l’aide du kit de purification BigDye XTerminator Applied Biosystems, conformément aux instructions du fabricant. Les produits purifiés ont été séquencés à l’aide d’un analyseur ABI Prism. Comme décrit par Sutherland et al , le polymorphisme de la longueur des fragments d’amplification et les mutations ponctuelles ont été analysés respectivement pour Potra et Porbp. Pour l’analyse statistique, toutes les données ont été saisies dans une base de données Excel. Test t de Student, ou tests Mann-Whitney / Wilcoxon

RÉSULTATS

L’étude de surveillance s’est déroulée de janvier à décembre. Le nombre moyen de soldats français en République de Côte d’Ivoire était jusqu’à et depuis que les forces armées françaises ont subi des attaques de paludisme liées à leur présence en République de Côte d’Ivoire. , y compris les cas de co-infection par P ovale-P falciparum Considérant les résultats épidémiologiques et parasitaires, un diagnostic erroné de Plasmodium vivax n’a pas pu être exclu dans les cas d’incidence maximale, ou si elle était ajustée au nombre de soldats. observé en juin La proportion d’attaques de P ovale parmi tous les cas de paludisme a progressivement augmenté avec un pic en, tandis que l’incidence mondiale du paludisme a diminué à la fin de la période d’étude

Tableau Incidence et proportion de Plasmodium ovale Attacksa parmi les forces armées françaises liées à un séjour en République de Côte d’Ivoire Année Personnes-années à risque Paludisme Incidence Taux d’incidence du paludisme par personne-années P ovale Incidence P ovale Taux d’incidence par personne-années P ovale Proportion,% Total Année-années-personnes à risque Incidence du paludisme Taux d’incidence du paludisme par personne-années P ovale Incidence P ovale Taux d’incidence par personne-années P ovale Proportion,% Total a Parmi toutes les attaques de paludisme déclarées de à View Large

Figure View largeTélécharger slideIncidence et taux d’incidence des attaques de Plasmodium ovale parmi les forces armées françaises liées à un séjour en République de Côte d’Ivoire * ans moyenne mobileFigure View largeTélécharger slideIncidence et taux d’incidence des attaques de Plasmodium ovale parmi les forces armées françaises liées à un rester en République de Côte d’Ivoire * années mobiles moyenneLa quasi-totalité des soldats infectés étaient des hommes n = [%], travaillant principalement dans l’armée% L’âge médian était de plusieurs années, – La majorité des patients n = [%] développaient des symptômes une fois qu’ils avaient retourné à une zone non endémique Le début de la maladie était en moyenne quelques jours après la médiane de retour; -, et jours après la fin de la chimioprophylaxie Une attaque prouvée antérieure de P ovale liée au même séjour en République de Côte d’Ivoire a été identifiée chez des soldats% avec de la doxycycline,% avec d’autres médicaments; P =; d’entre eux avait des rechutes Le temps moyen entre une attaque et sa rechute subséquente était des jours médians,; gamme, -Il était possible d’identifier les mêmes groupes de clusters et de rester: groupes de cas, de cas, de cas, et de cas jusqu’à. Le temps médian entre le premier et le dernier cas était de plusieurs jours, -comme mentionné, la chimioprophylaxie était doxycycline n = [%], chloroquine-proguanil n = [%], et méfloquine n = [%] L’observance de la chimioprophylaxie était disponible pour les soldats, et% déclaraient une conformité correcte% pendant le séjour vs% après le retour; P = Retard jusqu’à l’apparition des symptômes ne dépendait pas du type de chimioprophylaxie ou de compliance. Des résultats de tests de diagnostic étaient disponibles pour les attaques de P ovale. Le diagnostic était principalement établi avec un frottis sanguin épais et parfois avec des tests antigéniques uniquement quand aucun autre outil de diagnostic n’était disponible. sur le terrain Une bonne concordance a été trouvée entre les frottis sanguins positifs et les tests QBC / [%], alors qu’une concordance très faible a été trouvée avec les tests antigéniques / [%] La plupart des cas rapportés ont des caractéristiques classiques. L’accès à une unité médicale ou à un service hospitalier a été décidé dans les cas% Le délai médian d’invalidité était de plusieurs jours Le premier traitement rapporté des crises de P ovale était principalement la quinine% ou la chloroquine% La quinine était utilisée préférentiellement en cas de biparasitisme avec P. falciparum. Infection à P. vivax% vs% pour une attaque isolée de P ovale; P = -, et dans le champ% vs% pour les cas importés; P = – Les autres traitements étaient la méfloquine%, l’atovaquone plus le proguanil% et l’halofantrine% L’étude hospitalière sur les soldats revenant de la République de Côte d’Ivoire a permis une description clinique et biologique détaillée des attaques de P ovale. étaient de la fièvre & gt; ° C,%; & gt; ° C,%, maux de tête%, vomissements%, nausées%, douleurs abdominales% y compris cas d’hépatite ou cas de splénalgie,% splénomégalie,% toux,% diarrhée, ictère% et hépatomégalie% Les principaux changements biologiques sont indiqués dans le tableau. était% minimum =%, médiane =%, maximum =%

Tableau Les changements biologiques dans les attaques de Plasmodium ovale chez les soldats français Paramètres biologiques Fréquence Moyenne Minimum Médian Hémoglobine maximale & lt; g / dL% & lt; g / dL% de plaquettes & lt; / μL% & lt; / μL% de neutrophiles & lt; cellules / μL% & gt; cellules / μL% Lymphocytes & lt; cellules / μL% Bilirubine totale & gt; mmol / L% de lactate déshydrogénase & gt; Protéine IU / L% C-réactive & gt; mg / L% de créatinine & gt; μmol / L% Glycémie & lt; g / L% Alanine aminotransférase & gt; IU / L% aspartate aminotransférase & gt; IU / L% Gamma-glutamyl transferase & gt; IU / L% Temps de prothrombine & lt;%% Paramètres biologiques Fréquence Moyenne Minimum Médian Maximum Hémoglobine & lt; g / dL% & lt; g / dL% de plaquettes & lt; / μL% & lt; / μL% de neutrophiles & lt; cellules / μL% & gt; cellules / μL% Lymphocytes & lt; cellules / μL% Bilirubine totale & gt; mmol / L% de lactate déshydrogénase & gt; Protéine IU / L% C-réactive & gt; mg / L% de créatinine & gt; μmol / L% Glycémie & lt; g / L% Alanine aminotransférase & gt; IU / L% aspartate aminotransférase & gt; IU / L% Gamma-glutamyl transferase & gt; IU / L% Temps de prothrombine & lt;%% aSoldats revenant de la République de Côte d’Ivoire, Laveran, et les hôpitaux d’enseignement militaire de Begin, France, – ont été obtenus pour des isolats cliniques LargeNineteen recueillis entre et de soldats revenant de Côte d’Ivoire avec P ovale. investigations moléculaires Selon le polymorphisme mononucléotidique et le polymorphisme in / del dans les gènes Porbp et Potra, respectivement,% / des isolats de P ovale génotypés étaient des ovales classiques et ovales étaient des variants de P ovale wallikeri Les séquences étaient compatibles avec les haplotypes classiques et variants Tableau Parmi les haplotypes classiques, nous avons noté des polymorphismes mononucléotidiques supplémentaires dans Porbp aux codons A / T, C / G et T / C. De plus, les haplotypes classiques présentaient des allèles au locus de Potra, le bp attendu et une nouvelle taille de bp. fragment amplifié taille bp

Tableau Génotypage d’échantillons prélevés sur des soldats infectés après un séjour en République de Côte d’Ivoire PoRBP PoTRA Classic T G C T A T A T T A T A T T A T IF AFLP IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp ICb G A T G G T G A G G C G G T bp PoRBP PoTRA Classique T G C T A T A T A T A T A T A T A TION AFLP IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * * bp IC * * * * * * * * * * * * * * * * * * * Bp IC * * * * * * * * * * * * * * * * * * * * bp ICb G A T G G G T G G T G G G G G G T attendu La taille classique est bp et la taille du variant est bp Les astérisques indiquent les polymorphismes mononucléotidiques comme haplotypes classiques. Abréviation: AFLP, polymorphisme de longueur de fragment d’amplification Chez GU GU ou GU et les gènes de Potra GU, GU ou GUb Échantillon avec la variante haplotypeView Large

DISCUSSION

La sensibilité du test de diagnostic rapide n’était que de% dans notre série, et sa négativité ne peut pas exclure le diagnostic Aucun test de diagnostic rapide disponible aujourd’hui n’a la capacité de détecter un antigène spécifique de P ovale et donc un diagnostic spécifique. La PCR représente un véritable pas en avant dans la confirmation du diagnostic, mais elle n’est toujours pas disponible Notre génotypage de P ovale met en évidence non seulement un nouveau polymorphisme mais aussi l’existence de variants de P ovale déjà décrits dans d’autres pays ouest africains par Sutherland et al , et plus récemment en Côte d’Ivoire : P ovale curtisi / et P ovale wallikeri / La proportion de la variante% ne correspond pas au manque de sensibilité% C’est pourquoi faible sensibilité des tests biomoléculaires PCR et antigénique rapide les tests sont plus vraisemblablement expliqués par les polymorphismes. Ils peuvent affecter les régions géniques coïncidant avec les séquences des amorces utilisées dans les protocoles de PCR, ou peut-être les régions géniques coïncidant avec les anticorps. Gens utilisés dans les tests de diagnostic Le traitement des attaques de P ovale dans les séries rapportées était plutôt uniforme en relation avec une formation spécifique sur le traitement du paludisme pour tous les médecins militaires et avec les médicaments antipaludiques disponibles en France et sur le terrain. ont été traités avec de la quinine, avec un tiers pour le biparasitisme ou avec d’autres espèces de Plasmodium et environ un cinquième pour les vomissements. Les autres patients ont été traités conformément aux recommandations de l’Organisation Mondiale de la Santé, basées sur la chloroquine mg / kg pendant plusieurs jours. L’administration de primaquine mg / jour par jour a toujours débuté en France chez des patients sans déficit en GPD selon les recommandations françaises Malgré ces difficultés diagnostiques, la progression du taux d’incidence montre un pic épidémique d’attaques de P ovale chez les Français. forces armées Figure Le nombre réel d’attaques de P ovale était probablement plus élevé en considérant les difficultés de diagnostic R Etrospectivement, les attaques P ovale non diagnostiquées représentaient probablement une part importante des fièvres inexpliquées identifiées par les médecins militaires français en Côte d’Ivoire. Les taux de «fièvres inexpliquées» ont diminué depuis les années-personnes jusqu’à des années-personnes depuis les données de surveillance non publiées. disponible sur demande après la disponibilité des tests antigéniques sur le terrain. Néanmoins, en dépit de ces progrès, des attaques P ovale ont probablement été manquées avec ces tests peu sensibles, et de nombreux militaires traités pour le paludisme à P. ovale ont été déclarés éphémères et Fièvre bénigne survenant sur le terrain Nous excluons le rôle d’une propagation putative de P ovale wallikeri dans cette émergence parce que le pic épidémique s’est produit, alors que les seules épisodes variants trouvés se sont produits dans cette période. La Côte d’Ivoire a changé Alors que l’armée française était habituellement basée à Port Bouët Abidjan, effectuant des missions d’entraînement à la campagne, les troupes françaises ont été déployées dans tout le pays depuis la guerre civile jusqu’à Les principaux endroits où étaient stationnées les troupes étaient Abijdan, Bouaké et Yamoussoukro et l’arrière-pays des forêts et savanes, où l’incidence du paludisme est plus grande. Comme cela a déjà été démontré dans d’autres pays d’Afrique de l’Ouest , l’application de la stratégie de lutte contre les moustiques et le respect de la chimioprophylaxie n’ont pas joué un rôle dans cette tendance, comme ils l’ont fait en Côte d’Ivoire. pas de changement durant cette période Il est intéressant de noter que seulement% des patients ont appliqué toute la stratégie, ce qui pourrait plaider en faveur de son efficacité. Cette augmentation est survenue simultanément avec le changement de chimioprophylaxie de la chloroquine au proguanil à la doxycycline. médicament semble être le point clé de cette émergence de P ovale Doxycycline est efficace sur les stades sanguins de espèces de paludisme, mais pas sur les formes dormantes hépatiques de P ovale ; En revanche, il semble qu’une forte baisse du nombre total de cas de paludisme ait eu lieu au même moment, ce qui laisse penser que P falciparum a été beaucoup mieux maîtrisé. Cette épidémie de paludisme à P. ovale est apparue à la fin de la chimioprophylaxie. était responsable d’un lourd fardeau pour les forces françaises: morbidité et incapacité des soldats déployés sur le terrain ou après le retour, coûts de santé pour le diagnostic et le traitement et perte de confiance des troupes dans la chimioprophylaxie à la doxycycline. Guyana pour les épidémies de P. vivax Ces espèces de paludisme récurrentes et négligées posent le même problème de trouver une prévention idéale pour les forces déployées dans les zones endémiques à la fois pour le paludisme à P. falciparum et à P. falciparum. Aucune chimioprophylaxie bien tolérée n’a été validée. efficacité contre P falciparum, P vivax et P ovale

CONCLUSIONS

L’émergence du paludisme par Plasmodium ovale parmi les forces armées françaises en Côte d’Ivoire peut avoir eu de nombreuses causes, notamment une exposition accrue ou une faible efficacité de la doxycycline pour la prévention du paludisme à P. ovale. Sur le terrain, mais faute de sensibilité, de nombreuses attaques de P ovale restent mal diagnostiquées L’existence de polymorphismes plutôt que de variantes de P ovale pourrait expliquer ce phénomène. L’amélioration des outils de diagnostic est la clé pour proposer un traitement adéquat. Le Mali affectera probablement une fois de plus l’incidence du paludisme Cette émergence inattendue du paludisme à P ovale dans les forces armées françaises en Côte d’Ivoire souligne de nouveaux défis que les forces internationales récemment déployées en Afrique subsaharienne pourraient devoir affronter

Remarque

Conflits d’intérêts potentiels Tous les auteurs: Aucun conflit signalé Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent comme pertinents pour le contenu du manuscrit ont été divulgués

Maria Selma Restaurant, LLC – 1617 Richmond Ave, Houston Tx 77006
Website Developed by: E-nnovations Technologies and Marketing LLC