Menu

Maria Selma Restaurant

Présentation variable des infections mycobactériennes disséminées non tuberculeuses dans une famille avec une mutation du récepteur de l’interféron-γ

Des antécédents d’infections mycobactériennes disséminées chez le père et l’oncle du patient, à partir de ans et d’ans, ont été décrits. Une mutation autosomique dominante du récepteur de l’interféron γ a été identifiée par la suite. Variabilité clinique parmi les membres affectés de la même famille est cohérent avec les rapports précédents suggérant une variabilité substantielle dans l’évolution clinique de ce trouble

Depuis le rapport d’Engbaek , des regroupements familiaux d’infections mycobactériennes non mycobactériennes ont été reconnus L’évaluation immunologique initiale de ces patients n’a pas permis d’identifier les troubles immunitaires classiques. Ces sujets semblaient contenir des perturbations spécifiques affectant la réponse à l’infection NTM. Par la suite, d’autres patients présentant une prédisposition apparente à la MNT, ainsi que des infections à Salmonella non thyphoïdales, ont été identifiés. Rapports de maladie disséminée après vaccination avec le bacille Calmette-Guérin BCG ont encouragé les efforts pour élucider les déficiences immunitaires apparentes chez ces individus [, D’autres patients présentant une prédisposition apparente à des infections graves à MNT ont présenté des infections virales sévères avec des virus herpès, parainfluenza et respiratoire syncytial . Des études immunologiques ont démontré que la réponse immunitaire intacte aux organismes intramacrophages l’expression de IL- et IL-, conduisant à une série d’événements enzymatiques et de signalisation et entraînant la transcription de l’IFN-γ L’expression de l’IFN-γ par les cellules NK et T tueuses naturelles est suivie de la liaison de l’IFN-γ à Chaîne de liaison du ligand du récepteur IFN-γ IFN-γ R et IFN-γ récepteur transduction de la chaîne IFN-γ R par les neutrophiles et les macrophages et conduit à des voies effectrices pour la destruction intracellulaire des microbes ingérés Ainsi, IFN-γ et son récepteur sont Eléments clés pour lier l’immunité innée et adaptative, en particulier contre les infections à NTMDans les patients avec infections NTM sévères et / ou récidivantes, des mutations de perte de fonction dans le gène IFN-γR ont été identifiées Hérédité de ces mutations génétiques à la fois autosomique dominante et récessive Typiquement, de telles mutations aboutissent à un gène IFN-γ R tronqué, conduisant à une signalisation déficiente et entraînant des fonctions effectrices compromises La prédisposition héréditaire à la maladie grave des MNT a été désignée La susceptibilité mendélienne à la maladie mycobactérienne L’hérédité mendélienne chez l’homme Nous décrivons une famille dans laquelle les membres ont présenté des infections à MNT disséminées à cause d’une mutation autosomique dominante IFN-γ R, avec différents âges de présentation et table de résultats cliniques

un diagnostic spécifique In, l’évaluation radiologique a révélé des lésions destructives dans le cubitus droit, les fémurs distaux, le tibia proximal et distal et l’os frontal du crâne Après des mois de perte de poids et des sueurs nocturnes, une biopsie des lésions osseuses a révélé une NTM. Les tests cutanés avec PPD intermédiaire ont donné des résultats négatifs. L’état du patient s’est amélioré avec un traitement à base de streptomycine, d’isoniazide et d’acide para-aminosalicylique. Cependant, l’arrêt du traitement par streptomycine a entraîné une récurrence des symptômes tout au long de la vie. , qui a été diagnostiqué quand il était âgé de plusieurs années, il est mort après une septicémie à ligne centrale causée par une infection à Staphylococcus à coagulase négative. Méthodologie L’ADN génomique a été obtenu à partir d’échantillons de sang prélevés sur des patients. le gène IFN-γ R, comme décrit précédemment Exon de l’IFN-γ R a été amplifié par PCR a amorce directe séquencée bidirectionnellement γR / F: ‘CTTCTGCTTCCTTCAGTGTTC’; amorce inverse γR / R: ‘GCATGTGTGGTAGACTGACTG’; La PCR a été réalisée dans les conditions suivantes: cycles, température d’hybridation en ° C, MgCl mM; Résultats Les deux patients étaient hétérozygotes pour une délétion bêta-delta de TTAA dans l’exon de l’IFN-γ R Cette délétion est située dans le domaine intracellulaire de l’IFN. -γ R et conduit à un décalage de cadre et un codon d’arrêt prématuré aux positions – Les cartes de codons d’arrêt prédites en amont du site de liaison Jak, le domaine de recyclage des récepteurs, et le site de liaison de IFN-γ RD discussion non mycobactéries sont un groupe hétérogène de bacilles acido-résistants qui sont omniprésents dans l’environnement Bien que les mycobactéries non tuberculeuses soient communément perçues comme des agents pathogènes de faible virulence, les maladies NTM chez les humains ont été décrites depuis la fin de la maladie […] Les manifestations cliniques vont de la maladie granulomateuse focale La défense de l’hôte contre les pathogènes intracellulaires tels que les mycobactéries dépend de L’activation des cellules NK et des cellules Th se fait par IL- / IL- produite par les cellules présentatrices d’antigènes L’expression des cytokines induit ensuite la production d’INF-γ par les cellules NK et les cellules Th spécifiques de l’antigène de l’IFN-γ par les cellules NK et la production subséquente d’IFN-γ par les cellules Th favorise la destruction des mycobactéries dans les macrophages infectés, probablement en améliorant les facteurs mycobactéricides non encore définis Défauts dans les voies d’IL- / IL– L’immunité cellulaire dépendante de l’IFN-γ dépend de la sensibilité aux infections graves et récurrentes à NTM Des mutations ont été identifiées dans des gènes codant pour les protéines IFN-γ R, IFN-γ R, IL-B, IL-RB et Stat, dont le degré de l’altération de la fonction corrélée au résultat clinique L’IFN-γ agit à travers un récepteur de surface cellulaire composé de chaînes codant respectivement IFN-γ R et IFN-γ R La sous-unité codée par IFN-γ R est vitale pour liaison de ligand et transduction de signal Complet d L’efficacité de l’IFN-γ R en raison de mutations homozygotes entraîne souvent de graves infections par les MNT qui peuvent être réfractaires au traitement actuellement disponible Il est clair, cependant, qu’une déficience partielle ou complète en IFN-γ R peut être observée chez mutations négatives dominantes hétérozygotes ou mutations hypomorphiques récessives Les patients rapportés ici ont manifesté une maladie multifocale NTM qui était variablement sensible à l’intervention antimycobactérienne, qui est similaire aux patients précédemment signalés avec des mutations hétérozygotes La sélectivité relative et la sévérité clinique des infections à NTM dans les patients présentant des déficiences en IFN-γ R indiquent que l’axe IL- / IL- / INF-γ sert principalement de défense contre la maladie mycobactérienne. Cependant, d’autres facteurs sont susceptibles de contribuer au développement de la maladie NTM chez les sujets partiellement IFN-γ R Dans le présent rapport sur les membres de la famille, les infections initiales sont survenues à, et des années d’âge. Les facteurs immunologiques compensateurs et la variabilité de l’exposition aux mycobactéries non tuberculeuses La nature indolente et recrudescente de la maladie chez le patient et l’infection récurrente par une espèce différente de mycobactéries non tuberculeuses chez le patient suggèrent que ces patients peuvent bénéficier prophylaxie antimycobactérienne terme Cependant, le patient a été exempt de maladie pour & gt; En conclusion, il est noté que le patient a développé la maladie de Hodgkin à des années d’âge. La relation entre l’émergence de cette malignité et la mutation IFN-γ R est intrigante en vue de l’évolution de la maladie de Hodgkin. concepts du rôle de l’IFN-γ contre les tumeurs

Remerciements

Conflit d’intérêts Tous les auteurs: Pas de conflit

Maria Selma Restaurant, LLC – 1617 Richmond Ave, Houston Tx 77006
Website Developed by: E-nnovations Technologies and Marketing LLC